View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20571_low_13 (Length: 238)
Name: NF20571_low_13
Description: NF20571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20571_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 30844094 - 30844313
Alignment:
| Q |
1 |
ccacattctctttccaaattgacgcgactagaaaagcttaatttaaactcaaatcaattatccttgcttcccgattcaatcgggtcacttgttaacttaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30844094 |
ccacattctctttccaaattggcgcgactcgaaaaacttaatttaaactcaaatcaattatccttgcttcccgattcaatcgggtcacttgttaacttaa |
30844193 |
T |
 |
| Q |
101 |
agattttaaatatcgaaacaaatgacctagaagaaattccacactcaattggtcattgttgttcccttaaagagctttgtgccgattacaatcggctcaa |
200 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30844194 |
agattttgaatatcgaaacaaatgacatagaagaaattccacactcaatcggtcattgttgttcccttaaagagctttgtgccgattacaatcggctcaa |
30844293 |
T |
 |
| Q |
201 |
agctttgcctgaagcagtag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30844294 |
agctttgcctgaagcagtag |
30844313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University