View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20572_high_9 (Length: 236)
Name: NF20572_high_9
Description: NF20572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20572_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 15 - 148
Target Start/End: Complemental strand, 52882201 - 52882067
Alignment:
| Q |
15 |
agggaaaaacagttaagataagttggatttcaaatgctagaatgatgagagcagaaagaagtcaagctcatgttc-ttagaattacttgacgaattcgtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52882201 |
agggaaaaacagttaagataagttggatttcaaatgctagaatgatgagagcagaaagaagtcaagctcatgttctttagaattacttgacgaattcgtt |
52882102 |
T |
 |
| Q |
114 |
gatacctctacaatccagtatacaagattgttatg |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52882101 |
gatacctctacaatccagtatacaagattcttatg |
52882067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University