View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_high_29 (Length: 356)
Name: NF20573_high_29
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 4e-20; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 64 - 122
Target Start/End: Complemental strand, 31037151 - 31037093
Alignment:
| Q |
64 |
gtatagttatctttaagaaggaagaaaatagagctgagtgagaatgttcaaaaaggaat |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31037151 |
gtattgttatctttaagaaggaagaaaatagagctgagagagaatgttcaaaaaggaat |
31037093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 298 - 356
Target Start/End: Complemental strand, 31037022 - 31036964
Alignment:
| Q |
298 |
aaggcaccacacaagctttaagaaacttgaccaatccttaatgtcacataatcaaactt |
356 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
31037022 |
aaggtaccacacaagctttaagaaacttgaccaaaccttaatgtcaaataatccaactt |
31036964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 199 - 269
Target Start/End: Complemental strand, 31074289 - 31074219
Alignment:
| Q |
199 |
tgatgtatgctcaaaagaaacttgattcaatttcaatactagtgctcgaaatacttcggttgtctaatgtt |
269 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||| | ||||| ||||| |||| || ||||||||| |
|
|
| T |
31074289 |
tgatgtgtgctcaaaagaaacttaatttaatttcaataccaatgctcaaaataattcgattctctaatgtt |
31074219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University