View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_high_37 (Length: 327)
Name: NF20573_high_37
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 315
Target Start/End: Complemental strand, 47037593 - 47037287
Alignment:
| Q |
14 |
tcaatagaccatcaacgcctataaaaaggcactgttagccatcaaaaggtactaacaatataaagtttaacctctcactct-----cttttattagcttg |
108 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
47037593 |
tcaatagaccatcaacacctataaaaaggcactgttagccatcaaaaggtaattacaatataaagtttaacctctcactctttgctcttttactagcttg |
47037494 |
T |
|
| Q |
109 |
agcgtaaaagtgtgtgcaaatactcacaactcgcatattgacggtcattgctccaattcgcgttgaggtagttgttgcttgacaaacaaaatcattctaa |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47037493 |
agcgtaaaagtgtctgcaaatactcacaactcgcatattgacggttattgctccaattcgcattgaggcggttgttgcttgacaaacaaaatcattctaa |
47037394 |
T |
|
| Q |
209 |
tcactctatagcaatatgnnnnnnngaagacacttgcgttttttgtgaactatgttatcttgatgatgattgatcaaaatatgtgcaaatgcaattaacc |
308 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47037393 |
tcactctatatcaatatgttttttttaagacacttgcgttttttgtgaactatattatcttgatgatgatagatcaaaatatgtgcaaatgcaattaacc |
47037294 |
T |
|
| Q |
309 |
aatgtga |
315 |
Q |
| |
|
||||||| |
|
|
| T |
47037293 |
aatgtga |
47037287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University