View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_high_43 (Length: 297)
Name: NF20573_high_43
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 119
Target Start/End: Original strand, 19942702 - 19942803
Alignment:
| Q |
18 |
gagatgataatatttgtgagtacctatctcaaccaaaatttgatttttggttgtgggaatcaaatggttcatttgagtttcagttaaacaataaattaaa |
117 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |||||||| ||||| | | ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
19942702 |
gagatgctaatattcgtgagtacctatctcaaccaaaatttgacttttggttttgggagtgagatggttcatttaattttcagttaaacaataaattaaa |
19942801 |
T |
 |
| Q |
118 |
at |
119 |
Q |
| |
|
|| |
|
|
| T |
19942802 |
at |
19942803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 152 - 273
Target Start/End: Complemental strand, 24841057 - 24840933
Alignment:
| Q |
152 |
ctttctaattggaccaaactagtagcccttaacataaaaattgcgtttgtcttctcg---acaaaatcacaacattgaacaaatgtacaatttgggttta |
248 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||| | || |||||||| | | ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
24841057 |
ctttgtaattggaccaaactagtggcccttaacataaaaatggtgtgtgtcttcttgtttaagaaatcacaacattcaacaaatgaacaatttgggttta |
24840958 |
T |
 |
| Q |
249 |
tgaacaaattagcatttttgcatgt |
273 |
Q |
| |
|
|| |||||||||| |||||||||| |
|
|
| T |
24840957 |
tgtacaaattagctgttttgcatgt |
24840933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University