View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_high_50 (Length: 255)
Name: NF20573_high_50
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_high_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 31937316 - 31937551
Alignment:
| Q |
1 |
agcagagacatgtgtgcattttaagtaatgtggcactgccacatgtattttagtggtactgaagtaggnnnnnnnnnnnnnnnnnnnnaaagtgatgtgg |
100 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
31937316 |
agcagtgacatgtgtgcatttcaagtaatgtggcactgccacatgtattttagtggtgttgaagtaggttttttgaatttttttt---aaagtgatgtgg |
31937412 |
T |
 |
| Q |
101 |
catccacgactaaggcaagggcaacatatgtgaccctgatttgcaagaattttaagaaggggaagcaaattatgtgtcgacagggacttgggcgagcggc |
200 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31937413 |
catccacgactaagacaaaggcaacatatgtgaccctgatttgcaagaattttaagaaggagaagcaaattatgtgtcgacagggacttgggcgagcggt |
31937512 |
T |
 |
| Q |
201 |
tgttcatcgttcgtgcatgttcctcaagtttagtttgtt |
239 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
31937513 |
tgttcctcgttcgtgcatgtttctcaagtttagtttgtt |
31937551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 108 - 238
Target Start/End: Original strand, 48393445 - 48393579
Alignment:
| Q |
108 |
gactaaggcaagggcaacatatgtgaccctgatttgcaagaattttaagaaggggaagcaaattatgtgtcgacagggacttgggcgagcggctgttcat |
207 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| || ||||||| |||||||||||||||| || |||||| | |||||||| |||| | ||||| |
|
|
| T |
48393445 |
gactaaggcaaaagcaacatatgtgaccttgatatgtaagaattgtaagaaggggaagcaagttccgtgtcggccaggacttggtggagcagttgttcca |
48393544 |
T |
 |
| Q |
208 |
cgttcgtg----catgttcctcaagtttagtttgt |
238 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| |
|
|
| T |
48393545 |
cgttcatgtgatcatgttcctcaggtttagtttgt |
48393579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University