View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_high_58 (Length: 242)
Name: NF20573_high_58
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 23 - 226
Target Start/End: Complemental strand, 37344716 - 37344513
Alignment:
| Q |
23 |
atcaaaatcatgattccttgaactccaacgccgattattagtattgttagtcgtttgtctctacccacttgtcagtacctatgagccatcaacaatttgc |
122 |
Q |
| |
|
||||||||||||||||||||||||||| | || |||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37344716 |
atcaaaatcatgattccttgaactccagcatcggttatcagtattgttagtcgtttgtctctgcccacttgtcagtacctatgagccaccaacaatttgc |
37344617 |
T |
 |
| Q |
123 |
caaaatctgcaaaatcaaggtggctcggtgtgactttgtcaaacccatcacaatatcaaatatgcactaaggaatcaagtgatttattatgatacttaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37344616 |
caaaatctgcaaaatcaaggtggctcggtgtgattttgtcaaacccatcacaatatcaaatatgcattaaggaatcaagtgatttattatgatacttaaa |
37344517 |
T |
 |
| Q |
223 |
attt |
226 |
Q |
| |
|
|||| |
|
|
| T |
37344516 |
attt |
37344513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University