View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_27 (Length: 362)
Name: NF20573_low_27
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_27 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 169 - 362
Target Start/End: Complemental strand, 47100429 - 47100236
Alignment:
| Q |
169 |
ccaggatcatcatatgataatagaagcttgatgcatgtgtcttggaaggctcaaccaagtggttggcattgtctaaatatagatggtgcagccaagataa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100429 |
ccaggatcatcatatgataatagaagcttgatgcatgtgtcttggaaggctccaccaagtggttggcattgtctaaatatagatggtgcagccaagataa |
47100330 |
T |
|
| Q |
269 |
ctaataaagtagcatgttatggtggagttttacgtgatgataatggaaggtgggttgtaggttttatgaaacatcttggacacacaagtgctta |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100329 |
ctaataaagtagcatgttatggtggagttttacgtgatgataatggaaggtgggttgtaggttttatgaaacatcttggacacacaagtgctta |
47100236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 8 - 171
Target Start/End: Complemental strand, 47100625 - 47100462
Alignment:
| Q |
8 |
atatgaatcataatattggacaataactatagtaccagtggagtgcagtgtgggggactatttgctatcggctatggtgttggcggaataaacgggtgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100625 |
atatgaatcataatattggacaataactatagtaccagtggagtgcagtgtgggggactatttgctatcggctatggtgttggcggaataaacgggtgca |
47100526 |
T |
|
| Q |
108 |
tgatccaaatttgttaggccttttaaaccgtggtgccatatttttaacttactgcaattttcca |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47100525 |
tgatccaaatttgttaggccttttaaaccgtggtgccatatttttaacttactgcaattttcca |
47100462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University