View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_35 (Length: 338)
Name: NF20573_low_35
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 16 - 324
Target Start/End: Complemental strand, 38793026 - 38792717
Alignment:
| Q |
16 |
cagagatctagttatatttaagctaatattttcgcgtaaagagaagagaacaactacgttgggttccaattcaaagaagatatggcttccaagattggat |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38793026 |
cagagatctagttatatttaagctaatgttttcgcgtaaagagaagagaacaactacgttgggttccaattcaaagaagatatggcttccaagattggat |
38792927 |
T |
 |
| Q |
116 |
tttaaaaataggtggccacagggttggtgttaattgagtattgagtatattgtttatgttattaatgtgaaaattgctgctactactcccttgtggtctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38792926 |
tttaaaaataggtggccacagggttggtgttaattgagtattgagtatattgtttatgttattaatgtgaaaattgctgctactactcccttgtgatctg |
38792827 |
T |
 |
| Q |
216 |
aaaatggtatatgaatgttaagacgtttcatgcatctaataccataaatgtttctttcttctttctttgattaaaggttgaagctgctatt-atttctat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38792826 |
aaaatggtatatgaatgttaagacgtttcatgcatctaataccataaatgtttctttcttctttctttgattaaaggttgaagctgctattaatttctat |
38792727 |
T |
 |
| Q |
315 |
gataattttg |
324 |
Q |
| |
|
|||||||||| |
|
|
| T |
38792726 |
gataattttg |
38792717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University