View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_40 (Length: 310)
Name: NF20573_low_40
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 300
Target Start/End: Original strand, 35076474 - 35076744
Alignment:
| Q |
18 |
ggattatgattgagatttgattatttgatgaattcgtgtttactttattactagtggcttctgattttcatgagaacgtgcgcagatgcatagtatttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35076474 |
ggattatgattgagatttgattatttgatgaattcgtgtttattttattactagtggcttctgattttcatgagaacgtgcgcagatgcatagtatttta |
35076573 |
T |
 |
| Q |
118 |
tttgagaagaagatatttgtcgcaagctagatcgatatacaaaatttgaagtaaactaaactagtaatagtatatagcagtgtggaatttcat-aagtgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
35076574 |
tttgagaagaagatatttgtcgcaagctagatcgatatacaaaatttgaagtaaactaaattagtaata-------------tggaatttcataaagtgt |
35076660 |
T |
 |
| Q |
217 |
catggtcatgatgtactttttcagtaataatgtttccttatcagccgtaccataattttgtagcagctcacacgtgtgtctgtg |
300 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35076661 |
catggtcatgatgtactttttcaataataatgtttccttatcatccgtaccataattttgtagcagctcacacgtgtgtctgtg |
35076744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University