View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_41 (Length: 309)
Name: NF20573_low_41
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 37 - 291
Target Start/End: Original strand, 19343675 - 19343929
Alignment:
| Q |
37 |
catccttctgttgctaggaatttctataacctggttagtcaaatttttcaggagcaagttgtttggtggcttcacctgccgagcgagatcgaggtggaac |
136 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19343675 |
catccttctgttgctaggaatttctgtaacctggttagttaaatttttcaggagcaagttgtttggtggcttcacctgccgagcgagatcgaggtggaac |
19343774 |
T |
 |
| Q |
137 |
atccaaacttgcagatgccatgtaagtgtaatcaaaatttatggcatgacaataagaaaaacatggtcacatagaaaagatgcatctatataaacttttt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19343775 |
atccaaacttgcagatgccatgtaagtgtaatcaaaatttatggcatgacaataagaaaaacatggtcacatagaaaagatgcatctatattaacttttt |
19343874 |
T |
 |
| Q |
237 |
tggctttcaattttattctgatggcatgaaaaaggatacataaacatgcttaagt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19343875 |
tggctttcaattttattctgatggcatgaaaaaggatacataaacatgcttaagt |
19343929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 19342847 - 19342819
Alignment:
| Q |
1 |
cagaagcagattttccattagtgtgacca |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19342847 |
cagaagcagattttccattagtgtgacca |
19342819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University