View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_52 (Length: 254)
Name: NF20573_low_52
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 49 - 239
Target Start/End: Original strand, 47037650 - 47037840
Alignment:
| Q |
49 |
tctttatctgtatttggacttcgcgggattgaacctttgctcgacaggtgttgagtttgagcatttggcatgtccagcatacatattcataaactaaaat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037650 |
tctttatctgtatttggacttcgcgggattgaacctttgctcgacaggtgttgagtttgagcatttggcatgtccagcatacatattcataaactaaaat |
47037749 |
T |
|
| Q |
149 |
tcatatcaaattaaggaagaaaatatcaatcaacaaaatatggttattttgattcaattatctatgtccagccctgttacaaattccaaac |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47037750 |
tcatatcaaattaaggaagaaaatatcaatcaacaaaatatggttattttgattcaattatctatgtccagccctgttacaaattccaaac |
47037840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 47037595 - 47037627
Alignment:
| Q |
17 |
ttggacctagtgtttggttctaagagtagtgtt |
49 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
47037595 |
ttggacctagtgtttgggtctaagagtagtgtt |
47037627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University