View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_53 (Length: 250)
Name: NF20573_low_53
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 65 - 237
Target Start/End: Complemental strand, 42065450 - 42065278
Alignment:
| Q |
65 |
cttaataaatcgagttttgttgtaataattagattaatttaggcttgtagaacatgcagagcacttgattaagcccgatctgttgttttgttctaaaaac |
164 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42065450 |
cttaataaatcaagttttgttgtaataattagattaatttaggcttgtagaacatgcagagcacttgattaagcccgatctgttgttttgttctaaaaac |
42065351 |
T |
 |
| Q |
165 |
agagtgaatttgaattaaaaaataattatatttttcttttctcttgtgttttatgattcccctggatttgttc |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42065350 |
agagtgaatttgaattcaaaaataattatatttttcttttctcttgtcttttatgattcccctggatttgttc |
42065278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University