View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_59 (Length: 244)
Name: NF20573_low_59
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_59 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 61 - 244
Target Start/End: Original strand, 31036698 - 31036881
Alignment:
| Q |
61 |
aaaattacaaagttacttcttataaattcttccacaagataatagtgaaagttgcttgttcatcttggccacttagtcagatattttgtatcatcatgtt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||| ||| |
|
|
| T |
31036698 |
aaaattacaaagttacttcttataaattcttccacaagataatagtgaaagttgcttgttcatcttagccacttagtcagaaattttgtattctcacgtt |
31036797 |
T |
|
| Q |
161 |
ggagcaatagtagcatctcaaaataatttgggaccaggactcatcaaatgcgtttgatgg-taaggcgttggtgtaaggtctaat |
244 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||| | ||||| |||||||||| ||| |||||||| |
|
|
| T |
31036798 |
ggagcaatagtagcatctc-aaacaatttgggaccaggactcatcaaatgcgctggatggcaaaggcgttggcgtatggtctaat |
31036881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 75
Target Start/End: Original strand, 31036623 - 31036681
Alignment:
| Q |
17 |
acatacaatataccagctttatgcttggcataaccgctcattataaaattacaaagtta |
75 |
Q |
| |
|
|||||||||||| |||||| || |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
31036623 |
acatacaatataacagcttgatacttgacataaccgttcattataaaattacaaagtta |
31036681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University