View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20573_low_64 (Length: 236)
Name: NF20573_low_64
Description: NF20573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20573_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 47592788 - 47592958
Alignment:
| Q |
1 |
cctgcacaaaatgaatgtcagatgtggggtatgggatactagggcttacgttgcatttttatttgtgattaggcttttgcgtgaacaattacgaacttgt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47592788 |
cctgcacaaaatgaatggcagatgtggggtatgggatactagggcttacgttgcatttttatttgtgattaggcttttgcgtgaacaattacgaacctgt |
47592887 |
T |
|
| Q |
101 |
ttcatgtgattatgtgcatgcatgatcattatgttgttttaggattcttcaatagctgagacttctaagaa |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47592888 |
ttcatgtgattatgtgcatgcatgatcattatgttgttgtaggattcttcaatagctgagacttctaagaa |
47592958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 167 - 196
Target Start/End: Complemental strand, 47591463 - 47591434
Alignment:
| Q |
167 |
aagaataaattgggaagatagatagatcga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47591463 |
aagaataaattgggaagatagatagatcga |
47591434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University