View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20574_low_13 (Length: 260)
Name: NF20574_low_13
Description: NF20574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20574_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 114 - 247
Target Start/End: Original strand, 410238 - 410371
Alignment:
| Q |
114 |
gcaaggcgtgcaaaaggattaggaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtgctgttggtgtggaattagtctcatttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
410238 |
gcaaggcgtgcaaaaggattaggaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtgctgttggtgtggaattagtttcatttg |
410337 |
T |
|
| Q |
214 |
atcaagcaatcacaaccgctgatttcatctcact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
410338 |
atcaagcaatcacaaccgctgatttcatctcact |
410371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University