View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20574_low_18 (Length: 225)
Name: NF20574_low_18
Description: NF20574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20574_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 42982289 - 42982102
Alignment:
| Q |
19 |
gttttgccaggaaaattgaggttatctaatagtaagacaccagcggttaaacctaaaccgtattgcactaaataagaagggcaagtgatgttgttacagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42982289 |
gttttgccaggaaaattgaggttatctaatagtaagacaccagcggttaaacctaaaccgtattgcactaaataagaagggcaagtgatgttgttacagt |
42982190 |
T |
|
| Q |
119 |
ttcgtgtatttggattgcaaccttggcaacgagattcgatgtcgggtccgaaaatataaccgcatttggggtttgtgcagcctaagat |
206 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42982189 |
tttgtgtatttggattgcaaccttggcaacgagattcgatgtcgggtccgaaaatataaccgcatttggggtttgtgcagcctaagat |
42982102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University