View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20575_low_9 (Length: 309)
Name: NF20575_low_9
Description: NF20575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20575_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 10 - 294
Target Start/End: Original strand, 38711849 - 38712133
Alignment:
| Q |
10 |
agatgaaaagttagaaggaagtgtgatgcaggatttatagttgatcaaaaagtgtttctcttttatgtgataaatagaacaagagtattctttttactta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38711849 |
agatgaaaagttagaaggaagtgtgatgcaggatttatagttgatcaaaaagtgtttctcttttatgtgataaatagaacaagagtattctttttactta |
38711948 |
T |
|
| Q |
110 |
aaaattataaatttcataagaatctatccatgacttaaaaagtaataaatatcttatgaactatggtctgaagacgagcaatatactggttattcttctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38711949 |
aaaattataaatttcataagaatctatccatgacttaaaaagtaataaatatcttatgaactatggtctgaagacgagcaatatactggttattcttctt |
38712048 |
T |
|
| Q |
210 |
ctgaattaatgttgtgcttgatttgagtttgctttcgcggttcaagtgatgctacaatcagaaagatcactacgtagcaaccttc |
294 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38712049 |
ctgaattaatgttgtgcttgatttgtgtttgcttttgcggttcaagtgatgctacaatcagaaagatcactacgtagcaaccttc |
38712133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University