View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20576_high_9 (Length: 247)
Name: NF20576_high_9
Description: NF20576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20576_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 48476381 - 48476165
Alignment:
| Q |
18 |
agatgagtctaatttttaagcttagcatgatcttgaggagcaaggtacatacatgttaaagattctgttattgctgcaactaaccatattattcaagatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48476381 |
agatgagtctaatttttaagcttagcatgatcttgaggagcaaggtacatacatgttaaagattctgttattgctgcaactaaccatattattcaagatt |
48476282 |
T |
 |
| Q |
118 |
gcaaaccttgaatgtagtttacgtctctcatataagtagaaccttgaatgtttagggtcgtgaacttgttgattgaaacccttgttagtttcatagactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48476281 |
gcaaaccttgaatgtagtttacgtctctcatataagtagaaccttgaatgtttagggtcgtgaacttgttgattgaaacccttgttagtttcatagactt |
48476182 |
T |
 |
| Q |
218 |
ggttggggaacccccac |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
48476181 |
ggttggggaacccccac |
48476165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 79 - 227
Target Start/End: Complemental strand, 40963582 - 40963423
Alignment:
| Q |
79 |
attctgttattgctgcaactaaccatattattcaagattgcaaaccttgaatgtagtt-tacgtctctcatataagta----gaaccttgaat-----gt |
168 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||| || | | |||| | ||||||||||||||||| ||||||||||| || |
|
|
| T |
40963582 |
attctcttattgctgcaactgaccatattattcaagattgcaaggatttagcg-agttgttcgtctctcatataagtaagtagaaccttgaattgaatgt |
40963484 |
T |
 |
| Q |
169 |
ttagggtcgtgaacttgttgattga--aacccttgttagtttcatagacttggttggggaa |
227 |
Q |
| |
|
|||| |||||||||||||| || | || ||||||||||||||||||||||||||||||| |
|
|
| T |
40963483 |
ataggctcgtgaacttgttggtttagcaaaccttgttagtttcatagacttggttggggaa |
40963423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University