View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20576_low_10 (Length: 228)
Name: NF20576_low_10
Description: NF20576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20576_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 85 - 204
Target Start/End: Complemental strand, 25250956 - 25250837
Alignment:
| Q |
85 |
gttatcccttcacggaccaactacaacaagctcgagactctaatagaaacagacggtaagctctatgctctattttcttgcaaagcgtttacctatcttg |
184 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
25250956 |
gttatcccttcacggaccgactacaacaagctcgagactctaatagaaacagacggtaagctctctgctctatttgcttgcaaagcgtttacctatcttg |
25250857 |
T |
 |
| Q |
185 |
gcgaacgcttctgtaacctt |
204 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25250856 |
gcgaacgcttctgtaacctt |
25250837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 85 - 156
Target Start/End: Complemental strand, 19093780 - 19093709
Alignment:
| Q |
85 |
gttatcccttcacggaccaactacaacaagctcgagactctaatagaaacagacggtaagctctatgctcta |
156 |
Q |
| |
|
|||||||||||| || || ||||||||||||||| ||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
19093780 |
gttatcccttcatggtccgactacaacaagctcgcgactctaatagaaaccgacggtaagctctctgctcta |
19093709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 59
Target Start/End: Complemental strand, 25251633 - 25251589
Alignment:
| Q |
15 |
agtttgatgacaatattattagaatttgaattgacaacctttatc |
59 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25251633 |
agtttgatgacaatattattaaaatttgaattgacaacctttatc |
25251589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University