View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_high_13 (Length: 580)
Name: NF20578_high_13
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 198 - 565
Target Start/End: Original strand, 43766832 - 43767203
Alignment:
| Q |
198 |
gtggcccagttgctttttgcctcgtaaaagatcctatcaaatcttcttgtcccactcacacactttctctgctcttctcttctct----------caaac |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43766832 |
gtggcccagttgctttttgcctcgtaaaagatcctatcaaatcttcttgtcccactcacacactttctctgctcttctcttctcttctcttctctcaaac |
43766931 |
T |
 |
| Q |
288 |
gaggttcgtgtccctctcattccnnnnnnnnnnnnnnnnncctgcttcatcttgattcaactgaaaccccttttctcaatttcactgatttttgagttac |
387 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43766932 |
gaggttcgtgtccctctcattcctttttttttct------cctgcttcatcttgattcaactgaaaccccttttctcaatttcactgatttttgagttac |
43767025 |
T |
 |
| Q |
388 |
attagatctcatctatttgattcattggcgtgtcacattttgatttgtagattcttaatccatatagtttatttttagatccatgatttcaaatcttgta |
487 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43767026 |
attagatctcatctatttgattcattggcgtgtcacattttgatttgtagattcttaatccatatagtttatttttagatccatgatttcaaatcttgta |
43767125 |
T |
 |
| Q |
488 |
atgagttaatggttaagtttctatttttagctattattgatgtgttggtacttggtaatattaatgatttcaattttc |
565 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43767126 |
atgggttaatggttaagtttctatttttagctattattgatgtgttggtacttggtaatattaatgatttcaattttc |
43767203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 17 - 164
Target Start/End: Original strand, 43766643 - 43766790
Alignment:
| Q |
17 |
ttaggatttgtcgacnnnnnnngagtacagtaggtcttaatctcatggttgcattaatcaaactagtaatttcattttcagatcttaattacaaacnnnn |
116 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43766643 |
ttaggatttgtcgacagaaaaagagtacagtaggtcttaatctcatggttgcattaatcaaactagtaatttcattttcagatcttaattacaaactttt |
43766742 |
T |
 |
| Q |
117 |
nnnattcatatcgaaaaatttggaggcaacgtaagcaagttcgcagaa |
164 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43766743 |
tttatccatatcgaaaaatttggaggcaacgtatgcaagttcgcagaa |
43766790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University