View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_high_31 (Length: 366)
Name: NF20578_high_31
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 3e-70; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 219 - 353
Target Start/End: Complemental strand, 46455687 - 46455553
Alignment:
| Q |
219 |
ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactgaaggtgttggtttctcagttggaggatttgaaggagaattggattgagatggttt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455687 |
ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactgaaggtgttggtttctcagttggaggatttgaaggagaattggattgagatggttt |
46455588 |
T |
 |
| Q |
319 |
actactacataatcccttggtgcaatccacaggtt |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46455587 |
actactacataatcccttggtgcaatccacaggtt |
46455553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 46455905 - 46455756
Alignment:
| Q |
1 |
cggtggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtgatcgtgttcttcttttgggtgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46455905 |
cggtggaggtggtgaatgaactggtggtgaaggagaatgcacaggaggtggtgaggattgaactggtggcggcggtgatcgtgttcttcttttgggtgct |
46455806 |
T |
 |
| Q |
101 |
tcattatgaggatcatcctcaattggtggttctgcttgaggtgtagaagg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46455805 |
tcattatgaggatcatcctcaattggtggttctgcttcaggtgtagaagg |
46455756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 72
Target Start/End: Complemental strand, 46456267 - 46456197
Alignment:
| Q |
2 |
ggtggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtgg |
72 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||| || || || || ||||| ||||| |||||||| |
|
|
| T |
46456267 |
ggtggaggaggtgaatgaactggtggtggtggagaatgtactggtggaggaggggaatgaaccggtggtgg |
46456197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 46456048 - 46455975
Alignment:
| Q |
5 |
ggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtga |
78 |
Q |
| |
|
||||| ||||| ||||| |||||||| |||||||| || || ||||||||||| ||||||||||| || ||||| |
|
|
| T |
46456048 |
ggaggaggtgagtgaacaggtggtggtggagaatgaactggtggtggtggggagtgaactggtggaggaggtga |
46455975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 78
Target Start/End: Complemental strand, 46456009 - 46455933
Alignment:
| Q |
2 |
ggtggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtga |
78 |
Q |
| |
|
||||| ||||| || ||||||||||| ||||| || || || ||||||||||| || || ||||||||||| ||||| |
|
|
| T |
46456009 |
ggtggtggtggggagtgaactggtggaggaggtgagtgaacgggaggtggtggagagtgcactggtggtggtggtga |
46455933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University