View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20578_high_31 (Length: 366)

Name: NF20578_high_31
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20578_high_31
NF20578_high_31
[»] chr3 (5 HSPs)
chr3 (219-353)||(46455553-46455687)
chr3 (1-150)||(46455756-46455905)
chr3 (2-72)||(46456197-46456267)
chr3 (5-78)||(46455975-46456048)
chr3 (2-78)||(46455933-46456009)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 3e-70; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 219 - 353
Target Start/End: Complemental strand, 46455687 - 46455553
Alignment:
219 ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactgaaggtgttggtttctcagttggaggatttgaaggagaattggattgagatggttt 318  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46455687 ttggggtttgcgaaggtgtaggttgcggttgtggcttaggcactgaaggtgttggtttctcagttggaggatttgaaggagaattggattgagatggttt 46455588  T
319 actactacataatcccttggtgcaatccacaggtt 353  Q
    |||||||||||||||||||||||||||||||||||    
46455587 actactacataatcccttggtgcaatccacaggtt 46455553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 46455905 - 46455756
Alignment:
1 cggtggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtgatcgtgttcttcttttgggtgct 100  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||    
46455905 cggtggaggtggtgaatgaactggtggtgaaggagaatgcacaggaggtggtgaggattgaactggtggcggcggtgatcgtgttcttcttttgggtgct 46455806  T
101 tcattatgaggatcatcctcaattggtggttctgcttgaggtgtagaagg 150  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||    
46455805 tcattatgaggatcatcctcaattggtggttctgcttcaggtgtagaagg 46455756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 72
Target Start/End: Complemental strand, 46456267 - 46456197
Alignment:
2 ggtggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtgg 72  Q
    |||||||| |||||||||||||||||||| |||||||| || || || || ||||| ||||| ||||||||    
46456267 ggtggaggaggtgaatgaactggtggtggtggagaatgtactggtggaggaggggaatgaaccggtggtgg 46456197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 46456048 - 46455975
Alignment:
5 ggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtga 78  Q
    ||||| ||||| ||||| |||||||| |||||||| || || ||||||||||| ||||||||||| || |||||    
46456048 ggaggaggtgagtgaacaggtggtggtggagaatgaactggtggtggtggggagtgaactggtggaggaggtga 46455975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 2 - 78
Target Start/End: Complemental strand, 46456009 - 46455933
Alignment:
2 ggtggaggtggtgaatgaactggtggtggaggagaatgcacaggaggtggtggggattgaactggtggtggcggtga 78  Q
    ||||| ||||| || ||||||||||| ||||| || || || ||||||||||| || || ||||||||||| |||||    
46456009 ggtggtggtggggagtgaactggtggaggaggtgagtgaacgggaggtggtggagagtgcactggtggtggtggtga 46455933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University