View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_high_47 (Length: 287)
Name: NF20578_high_47
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 20896554 - 20896705
Alignment:
| Q |
18 |
gaaagtgcattgactctggttttgtttttaatagctggtgaagattttgataagcaattgcgtgaggatgacggaatgcaaagacatctcgaagatgact |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
20896554 |
gaaagtgcattgaccctggttttgtttttaatagctggtgaagattttgataagcatttgcgtgaggatgacggaatgcaaagaaatcaggaagatgact |
20896653 |
T |
 |
| Q |
118 |
atgccaaggatgagaatgagtcaaaggtctaatgacataattacatttactt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20896654 |
atgccaaggatgagaatgagtcaaaggtctaatgacataattacatttactt |
20896705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 247 - 287
Target Start/End: Original strand, 20896786 - 20896826
Alignment:
| Q |
247 |
ggctggataagctttaagtattaatttttaagttttttgtt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20896786 |
ggctggataagctttaagtattaatttttaagttttttgtt |
20896826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University