View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_high_51 (Length: 279)
Name: NF20578_high_51
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 12 - 261
Target Start/End: Original strand, 38930893 - 38931142
Alignment:
| Q |
12 |
gattattcttcaactcattcacttcttgtggactaagcccaaaaacatgagcaagtacttccccaggtgttgcactaatcgctgaatcacgccctatcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930893 |
gattattcttcaactcattcacttcttgtggactaagcccaaaaacatgagcaagtacttccccaggtgttgcactaatcgctgaatcacgccctatcat |
38930992 |
T |
 |
| Q |
112 |
tgtactaatctcagctctatcatttgttttgaaaactatgtattccaatccctcactctccgcctgttctgccaccgcgaaattctgcggcaccaccaac |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38930993 |
tgtactaatctcagctctatcatttgttttgaaaactatgtattccaatccctcactctccgcctgttctgccactgcgaaattctgcggcaccaccaac |
38931092 |
T |
 |
| Q |
212 |
aatcttcccctttttacctctccattgaacaccgattttccctcactatt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38931093 |
aatcttcccctttttacctctccattgaacactgattttccctcactatt |
38931142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University