View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_high_52 (Length: 277)
Name: NF20578_high_52
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_high_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 260
Target Start/End: Complemental strand, 5458268 - 5458024
Alignment:
| Q |
16 |
atttacattatcaagctaatggagttattttatcttatatgtttgtcataaggaaaacgttcttgtcgttttttcatttctttcttgtcattggacaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5458268 |
atttacattatcaagctaatggagtttttttatcttatatgtttgtcataaggaaaacgttcttgtcgttttttcatttctttcttgtcattggacaaat |
5458169 |
T |
|
| Q |
116 |
attatttgtctcacttgattgataaaatacttgtggacaacaattgaatcaaagagaggaagggaccaagttcaagattttaacctcaaatgacaaagta |
215 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5458168 |
ataatttgtctcatttgattgataaaatacttgtggacaacaattgaatcaaagagaggaagggaccaagttcaagattttaacctcaaatgacaaagta |
5458069 |
T |
|
| Q |
216 |
ttatccacgttctttgtctagtcgattgtcacatatatctttcat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5458068 |
ttatccacgttctttgtctagtcgattgtcacatatatctttcat |
5458024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University