View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_high_53 (Length: 272)
Name: NF20578_high_53
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 254
Target Start/End: Original strand, 36926826 - 36927063
Alignment:
| Q |
13 |
aatatggctaagggtcttgtatttagttattttctttgttaaacaataatagtggtggtgaacttggtaattttagattatattttagaataggcaagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36926826 |
aatatggctaagggtcttgtatttagttattttctttgttaaacaataatagtggtggtgaacttggtaattttagattatattttagaataggcaagta |
36926925 |
T |
 |
| Q |
113 |
aagtctttttactatttatcttcattatggtgtgctaaaacttgctatagagcatcatactattttctttacttcagtgaatattgagtcagtatttgag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36926926 |
aagtctttttactatttatcttcattatggtgtgctaaaacttgctatagagtatcatactattttctttacatcagtgaatattgagtcagtatttgag |
36927025 |
T |
 |
| Q |
213 |
ttcagcagtataatttctaacatcgatctactttacttatct |
254 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36927026 |
ttcagcagtataatttctaac----atctactttacttatct |
36927063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University