View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_17 (Length: 472)
Name: NF20578_low_17
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 14 - 457
Target Start/End: Complemental strand, 37335977 - 37335534
Alignment:
| Q |
14 |
tcatcatccccaacctcattttccattgccacaccatcatgaagatcatgttccattgcgtgcagatcatgatagtcgttttccccttcaccttgagcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37335977 |
tcatcatccccaacctcattttccattgccacaccatcatgaagatcatgttccattgcgtgcagatcatgatagtcgttttccccttcaccttgagcaa |
37335878 |
T |
 |
| Q |
114 |
gaagatcatcaccaaccacctagtttacaagttccacgcaagggaaaccgcatcagccaaccaccgcgtggaggctcgcgcaaaaagcatcgagatcaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37335877 |
gaagatcatcaccaaccacctagtttacaagttccacgcaagggaaaccgcatcagccaaccaccgcgtggaggctcgcgcaaaaagcatcgagatcaag |
37335778 |
T |
 |
| Q |
214 |
atcttcggccaggcaaatcaagggtaaattttcaagagccatcagtaataccaccaccgcttgatcaccctcctgagcctcggcggcaattgacaccaca |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37335777 |
atcttcggccaggcaaatcaagggtaaattttcaagagccatcagtaataccaccaccgcttgatcaccctcctgagcctcggcggcaattgacaccgca |
37335678 |
T |
 |
| Q |
314 |
ccaagagcggcgtcacggtggtataaggtttcctaaagaacaaaaatcaccacctttaacttggatgggcgcttgcttgtgtgtaatattttggcttatc |
413 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37335677 |
ccaagagcggcgtcatggtggtataaggtttcctaaagaacaaaaatcaccacctttaacttggatgggcgcttgcttgtgtgtaatattttggcttatc |
37335578 |
T |
 |
| Q |
414 |
attatcataggaggcataatagtcctcatagtgtacttggtttt |
457 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37335577 |
attatcataggaggcataatagtcctcatagtgtacttggtttt |
37335534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University