View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_21 (Length: 417)
Name: NF20578_low_21
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 404
Target Start/End: Complemental strand, 46873511 - 46873132
Alignment:
| Q |
18 |
aaaagagttcttcggatcttgagggacagattgattcctattacgacgtaaaagcgtcgggatctgtagaaaaagataaacaggcttctggatttcttgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
46873511 |
aaaagagttcttcggatcttgagggacagattgattcctattacgacgtaaaagcgtcgggatctgttgaaaaagataaacacgcttctggatttcttgg |
46873412 |
T |
|
| Q |
118 |
atcttttcgtttggtatgtttaaaactttcaattagctttctcatgattttggcttttcatatacgtatgtatgctttcatagttattactaattgaata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
46873411 |
atcttttcgtttggtatgtttaaaactttcaattagctttctcatgattttgtcttttcatatacg----tatgctttcatagttattagtaattgaata |
46873316 |
T |
|
| Q |
218 |
tgctatttttactttgattgtttataatttgagtgcgtaatcatgatataattcattcatagcttggcacagtatcactacttgactgaataatttcatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46873315 |
tgctatttttactttgattgtttataatttgagtgcgtaatcatgatataattcattcatagcttggcacagtatc---acttgactgaataatttcatc |
46873219 |
T |
|
| Q |
318 |
ttgaaaaactagtttacattgacggtgcatatcannnnnnnccccctgttttattcaaaattaggtttgttagacacttgcacaggt |
404 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46873218 |
ttgaaaaactagtttacactgacggtgcatatcatttttttccccctgttttattcaaaatcaggtttgttagacacttgcacaggt |
46873132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University