View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_22 (Length: 416)
Name: NF20578_low_22
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 77 - 404
Target Start/End: Complemental strand, 35849721 - 35849397
Alignment:
| Q |
77 |
ggaggaaccatctcaataattgtaatgtaattttcatcgttttctgttgttgataggtcttgtgttagagcagtttttctaataaattttttatttcttn |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35849721 |
ggaggaaccatctcaataattgtaatgtaattttcattgttttctattgttgataggtcttgtgttagagcagtttttctaataaattttttatttctta |
35849622 |
T |
|
| Q |
177 |
nnnnnnnnnnnnngtataatggtgaactcctccacaccttaaagttttattaaggtgaaagatcattaattttaaatttaaatttaattatcatactttt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35849621 |
aaaaaaaaaat--gtataatggtgaactcctccacaccttaaagttttattaaggtgaaagatcattaattttaaatttaaatttaattatcatactttt |
35849524 |
T |
|
| Q |
277 |
aatggattattgtatcttgcctnnnnnnntggattattaagagacaagttaacatggtagctcatggcttagcaaagtatcca-atttcttactaacccc |
375 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
35849523 |
aatggattattgtatcttgcctaaaaaaatggattattaagag--aagttaacatggtagctcatggcttagcaaagtatccatatttcttactagcccc |
35849426 |
T |
|
| Q |
376 |
acattctgtgatgatgtaccattttattg |
404 |
Q |
| |
|
||||||| ||||||||||||||||||||| |
|
|
| T |
35849425 |
acattctatgatgatgtaccattttattg |
35849397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University