View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_39 (Length: 336)
Name: NF20578_low_39
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 19 - 310
Target Start/End: Complemental strand, 14700433 - 14700142
Alignment:
| Q |
19 |
cattggttgcagtggctcaaagttctatggtactttgcagaatgagttaaagtacttgtttgtttcatgtgttgttttctcttttattgacacttataac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14700433 |
cattggttgcagtggctcaaagttctatggtacttcgcagaatgagttaaagtacttgtttgtttcatgtgttgttttctcttttattgacacttataac |
14700334 |
T |
 |
| Q |
119 |
tctccaagccttctctctgtcctagaagaaaatgaaagtgcagaaattttttctataatagaaagaggtgtaagtttccacaagggcacgtaggagaagg |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14700333 |
tctccaagccttttctctgtcctagaagaaaatgaaagtgcagaaattttttctataatagaaagaggtgtaagtttccacaagggcacgtaggagaagg |
14700234 |
T |
 |
| Q |
219 |
taaagaagcatcttattaggatttgtctttcatgaaagacagcaaaacaaattgaccaatgnnnnnnnggatcctccccactttctgtgctc |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14700233 |
taaagaagcatcttattaggatttgtctttcatgaaagacagcaaaacaaattgaccaatgaaaaaaaggatcctccccactttctgtgctc |
14700142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University