View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_41 (Length: 330)
Name: NF20578_low_41
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 312
Target Start/End: Complemental strand, 54266263 - 54265955
Alignment:
| Q |
1 |
tgtagtttgggtttacactttgcttttaggagcttcttttcttgcaatatgatttttaaaattgctcatatcttgatttatccattcagacnnnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266263 |
tgtagtttgggtttacactttgcttttaggagcttcttttcttgcaatatgatttttaaaattgctcatatcttgatttatccattcagacaaaaaaaaa |
54266164 |
T |
 |
| Q |
101 |
nnntaatcgttttgttcaaatttactcatccaaaatgaggctattttcctcttaggatgattctatggctatacgaccatgcagaaaatagttgttcctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||| |
|
|
| T |
54266163 |
a---aatcgttttgttcaaatttactcatccaacatgaggctattttcctcttaggatgattctatcgcaatacgaccatgcagaaaatatttgttcctg |
54266067 |
T |
 |
| Q |
201 |
ggaagtaattcaatgttgtaaagaaaacttgtttgaattctagaccaccaattaagcttcttataatttcaacaagtttgtggtgtttctaacaagctgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266066 |
ggaagtaattcaatgttgtaaagaaaacttgtttgaattctagaccaccaattaagcttcttataatttcaacaagtttgtggtgtttctaacaagctgg |
54265967 |
T |
 |
| Q |
301 |
catgtgccaaag |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54265966 |
catgtgccaaag |
54265955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University