View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_44 (Length: 311)
Name: NF20578_low_44
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 14 - 120
Target Start/End: Original strand, 21865215 - 21865320
Alignment:
| Q |
14 |
gagattgattgatatgagaagacattgtgtaggatataaactatattttttatacgaggattttcactttatattctgttttatgttaggtgtaggaatt |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21865215 |
gagattgattgatatgagaagccattgtgtaggatataa-ctatattttttatacgaggattttcactttatattttgttttatgttaggtgtaggaatt |
21865313 |
T |
 |
| Q |
114 |
atacgtt |
120 |
Q |
| |
|
||||||| |
|
|
| T |
21865314 |
atacgtt |
21865320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 230 - 294
Target Start/End: Original strand, 21865432 - 21865496
Alignment:
| Q |
230 |
tggctgcatacataggcttaattggtatagcactaattataggaatttgtaagatatgcaaatta |
294 |
Q |
| |
|
||||| ||| |||||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
21865432 |
tggctacatgcataggctgaattggtataggactaattataggaatttgttagatatgcaaatta |
21865496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University