View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_46 (Length: 295)
Name: NF20578_low_46
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 32 - 274
Target Start/End: Complemental strand, 9666261 - 9666019
Alignment:
| Q |
32 |
acatccaacaccaaaactcactgacccattttcacaaacaccttcaaaatcacaaccaacaccaaatctcaccgacccatcatctgaaatgacaaaagca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666261 |
acatccaacaccaaaactcactgacccattttcacaaacaccttcaaaatcacaaccaacaccaaatctcaccgacccatcatctgaaatgacaaaagca |
9666162 |
T |
 |
| Q |
132 |
ccctctccagcaccccatggttgataattgggggtgttgtgagagagaataagggaaggtgtgtagagaaagtaggagtaaggagggttgttgttgttgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666161 |
ccctctccagcaccccatggttgataattgggggtgttgtgagagagaataagggaaggtgtgtagagaaagtaggagtaaggagggttgttgttgttgt |
9666062 |
T |
 |
| Q |
232 |
tggtattgaaaaatgggattggataattctcgaaggttctgga |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9666061 |
tggtattgaaaaatgggattggataattctcgaaggttctgga |
9666019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University