View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20578_low_48 (Length: 287)

Name: NF20578_low_48
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20578_low_48
NF20578_low_48
[»] chr3 (2 HSPs)
chr3 (18-169)||(20896554-20896705)
chr3 (247-287)||(20896786-20896826)


Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 20896554 - 20896705
Alignment:
18 gaaagtgcattgactctggttttgtttttaatagctggtgaagattttgataagcaattgcgtgaggatgacggaatgcaaagacatctcgaagatgact 117  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||  ||||||||||    
20896554 gaaagtgcattgaccctggttttgtttttaatagctggtgaagattttgataagcatttgcgtgaggatgacggaatgcaaagaaatcaggaagatgact 20896653  T
118 atgccaaggatgagaatgagtcaaaggtctaatgacataattacatttactt 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
20896654 atgccaaggatgagaatgagtcaaaggtctaatgacataattacatttactt 20896705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 247 - 287
Target Start/End: Original strand, 20896786 - 20896826
Alignment:
247 ggctggataagctttaagtattaatttttaagttttttgtt 287  Q
    |||||||||||||||||||||||||||||||||||||||||    
20896786 ggctggataagctttaagtattaatttttaagttttttgtt 20896826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University