View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_62 (Length: 254)
Name: NF20578_low_62
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 28 - 238
Target Start/End: Original strand, 20398909 - 20399118
Alignment:
| Q |
28 |
aataaatagaagtatttatgcgtataattttgcaccacaaaataactacttaaatccattttttccataacaataataaatcaaattatcaatgaatatg |
127 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
20398909 |
aataaatagaagtatttaggcgtataattttgcacctcaaaataactacttaaatctattttttc-ataacgataataaatcaaattatcaatgaatatg |
20399007 |
T |
 |
| Q |
128 |
attaagaaacacaactatatactacttcagtcataccatactgataagagtggatatttagacatttataatttttcaatatttaatttcccttctatca |
227 |
Q |
| |
|
|||||||||||||| | | ||||||| | ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20399008 |
attaagaaacacaaatttctactactccgatcagaccatgctgataagagtggatatttagacatttataatttttcaatatttaatttcccttgtatca |
20399107 |
T |
 |
| Q |
228 |
gtttatgttac |
238 |
Q |
| |
|
|||||||||| |
|
|
| T |
20399108 |
atttatgttac |
20399118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University