View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_76 (Length: 235)
Name: NF20578_low_76
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 222
Target Start/End: Original strand, 45381287 - 45381496
Alignment:
| Q |
11 |
gagctagatttatatgtaacatattactttttccacttttcctagtttttgaattctaactaggctggcttataaagtttccttgcgatttgcattgttt |
110 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45381287 |
gagctagatttatatgtaacat--tactttttccacttttcctagtttttgaattctaactaggctggcttataaagtttccttgtgatttgcattgttt |
45381384 |
T |
 |
| Q |
111 |
tataatttcaatggcaacaatcagcaacattggcttacaagggaattggaatgtgagcaatgcaaagaaggaaaatatgatcaactcaaggaaggttttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45381385 |
tataatttcaatggcaacaatcagcaacattggcttacaagggaattggaatgtgagcaatgcaaagaaggaaaatatgatcaactcaaggaaggttttg |
45381484 |
T |
 |
| Q |
211 |
gaggtgaatttt |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45381485 |
gaggtgaatttt |
45381496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University