View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20578_low_80 (Length: 222)
Name: NF20578_low_80
Description: NF20578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20578_low_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 26 - 210
Target Start/End: Original strand, 7416337 - 7416521
Alignment:
| Q |
26 |
ctgctagctatatatgtctcaatcaaaagaagggttgaaggcacatgtaatgggtcagttaattacaaaacaagggaaatttttgtaaagtttgtgaatc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416337 |
ctgctagctatatatgtctcaatcaaaagaagggttgaaggcacatgtaatgggtcagttaattacaaaacaagggaaatttttgtaaagtttgtgaatc |
7416436 |
T |
 |
| Q |
126 |
ttcctaatgaactaaaaccagaagtctatgaaagtatcattaaccctatatcttatcatatgtacctcgacctatatcatatgtg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7416437 |
ttcctaatgaactaaaaccagaagtctatgaaagtatcattaaccctatatcttatcatatgtacctcgacctatatcatatgtg |
7416521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University