View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20579_high_24 (Length: 213)

Name: NF20579_high_24
Description: NF20579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20579_high_24
NF20579_high_24
[»] chr3 (1 HSPs)
chr3 (104-184)||(10371102-10371182)


Alignment Details
Target: chr3 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 104 - 184
Target Start/End: Complemental strand, 10371182 - 10371102
Alignment:
104 caaacaaccatagatgttgatattgagtactaatctttctcatacgaatgagtttaggattagtaattaaggaactccatt 184  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
10371182 caaacaaccatagatgttgatattgagtaccaatctttctcatacgaatgagtttaggattagtaattaaggaactccatt 10371102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University