View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20579_low_15 (Length: 272)
Name: NF20579_low_15
Description: NF20579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20579_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 22 - 256
Target Start/End: Complemental strand, 8067273 - 8067039
Alignment:
| Q |
22 |
gggggttgattcatatggttataacttggatcgtatcaaaatttctgctatggtaaattttgcttaatcatatcataaatatttgatgaaattttctctc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8067273 |
gggggttgattcatatggttataacttggatcgtatcaaaatttctgctatggtaaattttgcttaatcatatcaaaaatatttgatgaaattttctctc |
8067174 |
T |
 |
| Q |
122 |
taaccttgtaaaaagtgggccttgggttgtgaatccttctgcaatggttacgctgaggaaccattttatctgctggtttcgacggtagcttagcttttga |
221 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
8067173 |
taaccttgtaaaaagtgggccttggtttgtgaatccttctgcaatgtttgcgctgaggaaccattttatcggctggtttcgaaggtagcttagcttttga |
8067074 |
T |
 |
| Q |
222 |
tggctgtacaaagattttgttttatggtttgtttg |
256 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8067073 |
tggttgtacaaagattttgttttatggtttgtttg |
8067039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University