View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20579_low_21 (Length: 227)

Name: NF20579_low_21
Description: NF20579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20579_low_21
NF20579_low_21
[»] chr2 (1 HSPs)
chr2 (1-223)||(12073355-12073577)


Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 12073355 - 12073577
Alignment:
1 agcatgatggtttcaaagtgaataacataaaatagaaagttatctttactctaacagtagcatgtattttgataccccaaaatggcttacactgttcaaa 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12073355 agcatgatggtttcaaagtgaataacataaaacagaaagttatctttactctaacagtagcatgtattttgataccccaaaatggcttacactgttcaaa 12073454  T
101 atatcaaattgtatgacgaaagtacacattcccatcaaatctattcgcgtagcccgatcaaatgtgacaccctaaccagcttgatctattaatttgagaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12073455 atatcaaattgtatgacgaaagtacacattcccatcaaatctattcgcgtagcccgatcaaatgtgacaccctaaccagcttgatctattaatttgagaa 12073554  T
201 acaaacatgtaatgcaaaactgg 223  Q
    |||||||||||||||||||||||    
12073555 acaaacatgtaatgcaaaactgg 12073577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University