View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20579_low_25 (Length: 212)
Name: NF20579_low_25
Description: NF20579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20579_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 69
Target Start/End: Original strand, 14333272 - 14333322
Alignment:
| Q |
19 |
caattcgtctcttctattacccattttgtaaggattgaattttgtgtgtat |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14333272 |
caattcgtctcttctattacccattttgtaaggattgatttttgtgtgtat |
14333322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 131 - 168
Target Start/End: Original strand, 14333384 - 14333421
Alignment:
| Q |
131 |
ctgatgtgaagcttgtgtgattagggataaaattgtgt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14333384 |
ctgatgtgaagcttgtgtgattagggataaaattgtgt |
14333421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University