View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20579_low_3 (Length: 454)
Name: NF20579_low_3
Description: NF20579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20579_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 20 - 355
Target Start/End: Complemental strand, 45521048 - 45520713
Alignment:
| Q |
20 |
tttgggatgtatatgtctggtagtttcgacttgaatattatttcctttgtttcttgtttagatgatgccatttaattgaatgatcaatgaagaagaagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45521048 |
tttgggatgtatatgtctggtagtttcgacttgaatattatttcctttgtttcttgtttagatgatgccatttaattgaatgatcaatgaagaagaagaa |
45520949 |
T |
 |
| Q |
120 |
gatgtgaaattgtatctaatcttcttctaacttgttcaaatattggaaaccccgacaca--acaacagaacaagtaaataaccaatgcttgcttgcttgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||| |||||| |||||| ||||||||||| |
|
|
| T |
45520948 |
gatgtgaaattgtatctaatcttcttctaacttgttcaaatattggaaacccctacacaacacaacacaactagtaaacaaccaa----tgcttgcttgc |
45520853 |
T |
 |
| Q |
218 |
ttgctttagagttttaattaataatgtttatt--tatatataatagcaaaggattacggctccgcaattgttgttggtgaggggcaaatttgggatttac |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45520852 |
ttgctttagagttttaattaataatgtttatttatatatataatagcaaaggattacggctccgcaattgttgttggtgaggggcaaatttgggatttac |
45520753 |
T |
 |
| Q |
316 |
ggaaatgaaaacaattatttatacccataaaagttggtga |
355 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45520752 |
ggaaataaaaacaattatttatacccataaaagttggtga |
45520713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 366 - 443
Target Start/End: Complemental strand, 45520679 - 45520605
Alignment:
| Q |
366 |
gtcaatgagatcaaatcc---aaatttatgaggtcgggtttgggttccttctaaacccacccgatccatgatgcttttctt |
443 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
45520679 |
gtcaatgagatcaaatcctccaaatttattaggtcgggtt------ccctctaaacccacccgatccatgatgcttttctt |
45520605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University