View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_high_47 (Length: 242)
Name: NF2057_high_47
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_high_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 6392046 - 6391870
Alignment:
| Q |
1 |
catattacaacgttacatattgacgtgtctaacgtttagatttgacgaaggaactcatttgataagcctaaaataaattgaaagataattttgtcattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6392046 |
catattacaacgttacatattgacgtgtctaacgtttagatttgacgaaggaactcatttgataagcctaaaataaattgaaagataattttgtcattat |
6391947 |
T |
 |
| Q |
101 |
aaaatcataannnnnnnnnctttcgagaggaaacttatcaaaattaaactcatagaagtaacatatttcaacccctt |
177 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6391946 |
aaaatcataatttttttttctttcgagaggaaacttatcaaaattaaactcatagaagtaacatatttcaacccctt |
6391870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 226
Target Start/End: Complemental strand, 6391853 - 6391820
Alignment:
| Q |
193 |
gtaacatatttcaatggtattgcatacatgttga |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6391853 |
gtaacatatttcaatggtattgcatacatgttga |
6391820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University