View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_high_53 (Length: 235)
Name: NF2057_high_53
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_high_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 46261388 - 46261160
Alignment:
| Q |
1 |
ttactttttgcatggcgcccattcataaaatgaaaccatgatgcatgcatctgttagactcttgcatgcatctgaatgg-attattttttattattgtta |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46261388 |
ttactttttgcatggcgcccattcataaaatgaaaccatgatgcatgcatctgttagactcttgcatgcatctgaatgggattattttttattattgtta |
46261289 |
T |
 |
| Q |
100 |
ttgctattttataagcatctcttcagaatcctaacttgttagtgttgtagcaggaaggctctgtgtcccctgatatatacaccgacacagaagagagtgg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46261288 |
ttgctattttataagcatctcttcagaatcctaacttgttagtgttgtagcaggaaggctctgtgtcccctgatatatacaccgacacagaagagagtgg |
46261189 |
T |
 |
| Q |
200 |
gtctgagagtgaggaaggtactgatgatg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46261188 |
gtctgagagtgaggaaggtactgatgatg |
46261160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University