View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_high_54 (Length: 235)
Name: NF2057_high_54
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 27254662 - 27254443
Alignment:
| Q |
1 |
ctttgagaaaacctcaaaccccgagtggaaccaagtttttgctttttctaaagagaggattcaagaacaagttttggagattgttgtgaaggaaaaagat |
100 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27254662 |
ctttgagaaaatctcaaaccctgagtggaaccaagtttttgctttttctaaagagaggattcaagaacaagttttggagattgttgtgaaggaaaaagat |
27254563 |
T |
 |
| Q |
101 |
cccgttgctgatcaccctgatgtcattggtcgagtagcattcagaatttctgatattcctatgagggttcctcctgatagtcctttagcaccacaatggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27254562 |
cccgttgctgatcaccctgatgtcattggtcgagtagcattcacaatttctgatattcctatgagggttcctcctgatagtcctttagcaccacaatggt |
27254463 |
T |
 |
| Q |
201 |
ataagcttgagggtcaaaat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27254462 |
ataagcttgagggtcaaaat |
27254443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 21198820 - 21198601
Alignment:
| Q |
1 |
ctttgagaaaacctcaaaccccgagtggaaccaagtttttgctttttctaaagagaggattcaagaacaagttttggagattgttgtgaaggaaaaagat |
100 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21198820 |
ctttgagaaaatctcaaaccctgagtggaaccaagtttttgctttttctaaagagaggattcaagaacaagttttggagattgttgtgaaggaaaaagat |
21198721 |
T |
 |
| Q |
101 |
cccgttgctgatcaccctgatgtcattggtcgagtagcattcagaatttctgatattcctatgagggttcctcctgatagtcctttagcaccacaatggt |
200 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21198720 |
cccgttgctgattatccttatgtcattggtcgagtagcattcacaatttctgatattcctatgagggttcctcctgatagtcctttagcaccacaatggt |
21198621 |
T |
 |
| Q |
201 |
ataagcttgagggtcaaaat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21198620 |
ataagcttgagggtcaaaat |
21198601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University