View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_20 (Length: 388)
Name: NF2057_low_20
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 196 - 378
Target Start/End: Original strand, 55643786 - 55643968
Alignment:
| Q |
196 |
ttgtggttcactt-acgggcacggccattgcctctgtaccgctgtgctggttgcttcatcttgttgaggttcgtatgatttacttctttttcttctcacn |
294 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55643786 |
ttgtggttcactttacgggcacggccattgcctctgtaccgctgtgctggttgcttcatcttgttgaggttcgtatgatttacttctttttcttctcac- |
55643884 |
T |
|
| Q |
295 |
nnnnnnnattctccccaaagtttaacctaattatcaccatcaccataataataaactaattagttagtggctactacttctctg |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55643885 |
tttttttattctccccaaagtttaacctaattatcaccatcaccataataataaactaattagttagtggctactacttttctg |
55643968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 118 - 173
Target Start/End: Original strand, 55643703 - 55643758
Alignment:
| Q |
118 |
agataaaatttgattgattttggtaaatcacacatacatgttccgccggttaaatt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55643703 |
agataaaatttgattgattttggtaaatcacacatacatgttccgccggttaaatt |
55643758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University