View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_21 (Length: 385)
Name: NF2057_low_21
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 16 - 375
Target Start/End: Original strand, 48214058 - 48214417
Alignment:
| Q |
16 |
ttttgttgattctcaaggattattatattgtctgaatgatttttcgatcgtcaagggtgaacatgaccgatctgtatgtatgttcattcaacctgaatct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48214058 |
ttttgttgattctcaaggattattatattgtctgaatgatttttcgatcatcaagggtgaacatgaccaatctgtatgtatgttcattcaacctgaatca |
48214157 |
T |
|
| Q |
116 |
atgtaatttcattatctcatgttttatactcatatttcaaaaccttgtgtgtttatgcatgtttgatctatctatgtttacgctttatgggcaaacgcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
48214158 |
ttgtaatttcattatctcatgttttatactcatatttcaaaaccttgtgtgtttatgcatgttcgatctatctatgtttacgctttatgggcaaacgcat |
48214257 |
T |
|
| Q |
216 |
gtgttctcaccatttaatactaaaaaaggtttgtaatcttatacgtttatgttgattttgtgtttgagatctttatatgtgttaactataaaatatgttt |
315 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48214258 |
gtgttctcaccatttaattctaaaaaaggtttgtaatcttatacgtttatggtgattttgtgtttgagatctttatgtgtgttaactataaaatatgttt |
48214357 |
T |
|
| Q |
316 |
cagtatgatgtaggaactaatcggctcctaaccttcgatcagctcggtttgtaacctttg |
375 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
48214358 |
cagtatgatgtaggaactaatcggctcctgatcttcgatcagctcggtttgtaacctttg |
48214417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University