View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_32 (Length: 322)
Name: NF2057_low_32
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 13 - 145
Target Start/End: Original strand, 31856585 - 31856717
Alignment:
| Q |
13 |
aatatctaacaatttgaaggaaacaaaaaccatgttattggttttaaactttgggactcgtcatttgacataattaaattgtaattgtacttgctgcaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31856585 |
aatatctaacaatttgaaggaaacaaaaaccatgttattggtttaaaactttgggactcatcatttgacataattaaattgtaattgtacttgctgcaca |
31856684 |
T |
|
| Q |
113 |
aatcgaaatatttggacgccatcaaaatcataa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31856685 |
aatcgaaatatttggacgccatcaaaatcataa |
31856717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 191 - 306
Target Start/End: Original strand, 31856720 - 31856835
Alignment:
| Q |
191 |
aaaagtgaatataggtttttctaaccttgatctacatgtgcttttgacttgaattgttttgcaatttcttcacgcgatgaaaataatctcttcccctcat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31856720 |
aaaagtgaatataggtttttctaaccttgatctacatgtgcttttgacttgaattgttttgcaatttcttcaggcgatgaaaataatctcttcccctcat |
31856819 |
T |
|
| Q |
291 |
tattttcctttctttg |
306 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31856820 |
tattttcctttctttg |
31856835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University