View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_38 (Length: 287)
Name: NF2057_low_38
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 18 - 276
Target Start/End: Original strand, 39032660 - 39032912
Alignment:
| Q |
18 |
tatgatgttgaggttaagatcaaaagaaaatcaatgaggtaaaaactgttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39032660 |
tatgatgttgaggttaagatcaaaagaaaaccgatgaggttaaaagtgttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgtt |
39032759 |
T |
 |
| Q |
118 |
aattttaaggataatgctacttctctcgacatattttctagcaaaaagatgacgaccttgttgctagnnnnnnnnattgcaactacaattaatcaactct |
217 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||| |
|
|
| T |
39032760 |
aattttaaggataatgctacttctcgcgacata-tttctagcaaaaagatgacgaccttgttgctag-tttttttattgcaactac----aatcgactct |
39032853 |
T |
 |
| Q |
218 |
ttcttttttatccaaccacccatgatgtccaccaatttagatctaacggtgacattctt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39032854 |
ttcttttttatccaaccacccatgatgtccaccaatttagatctaacggtgacattctt |
39032912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University