View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2057_low_39 (Length: 287)
Name: NF2057_low_39
Description: NF2057
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2057_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 126 - 272
Target Start/End: Original strand, 7177671 - 7177818
Alignment:
| Q |
126 |
aacatatgcatgcaaacacaataaaggattaatccaccagcaatgtaaatcaaaagttaaattt-cgttgttagcttttaaccactaaaaagattaaaac |
224 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
7177671 |
aacatatgcatgcaaacacaagaaaggattaatccaccagcaatgtaaatcaaaagttaaattttcgttgttagcttttaaccactaaaaaaattaaaac |
7177770 |
T |
|
| Q |
225 |
ttcatattatcaaataaatgatttagagaagattcttatttatatttt |
272 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177771 |
tttatattatcaaataaatgatttagagaagattcttatttatatttt |
7177818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 7177570 - 7177612
Alignment:
| Q |
9 |
cacagagagtggaagataagaaatcaagagtcaatacaaagag |
51 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7177570 |
cacaaagagtggaagataagaaatcaagagtcaatacaaagag |
7177612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University